SubtiBank SubtiBank
Version comparison:

2019-08-05 08:53:342024-12-31 18:32:07

description

ATP-dependent DNA helicase, acts together with [[protein|RecJ]]

ATP-dependent DNA helicase, acts together with [[protein|RecJ]] in replication fork maintenance

function

control of DNA recombination, maintenance of genomic stability

replication fork maintenance

The protein

Catalyzed reaction/ biological activity

unwinds covalently closed ds DNA (in complex with [[protein|SsbA|SSB]]) [pubmed|10360177]

[[protein|RecQ ]]controls [[protein|TopB|Topo III]] (de)catenation activity [pubmed|11497238,10360177]

unwinds covalently closed ds DNA (in complex with [[protein|SsbA|SSB]]) [pubmed|10360177]

[[protein|RecQ ]]controls [[protein|TopB|Topo III]] (de)catenation activity [pubmed|11497238,10360177]

ATP + H2O --> ADP + H+ + phosphate (according to UniProt)

Biological materials

Mutant

MGNA-B414 (yocI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1413 NBRP B. subtilis, Japan]

BKE19220 (Δ[[gene|recQ]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGTGTAAACCTCGCT, downstream forward: _UP4_TAAAAAAACAGAAAAACAAT

BKK19220 (Δ[[gene|recQ]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGTGTAAACCTCGCT, downstream forward: _UP4_TAAAAAAACAGAAAAACAAT

GP3543 (Δ[[gene|recQ]]::kan), available in [SW|Jörg Stülke]'s lab

MGNA-B414 (yocI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1413 NBRP B. subtilis, Japan]

BKE19220 (Δ[[gene|recQ]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGTGTAAACCTCGCT, downstream forward: _UP4_TAAAAAAACAGAAAAACAAT

BKK19220 (Δ[[gene|recQ]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGTGTAAACCTCGCT, downstream forward: _UP4_TAAAAAAACAGAAAAACAAT

References

Reviews

11497238, 22933559, 15217989

11497238, 22933559, 15217989, 32286623

References

Original publications

25246477, 25243132

25246477, 25243132, 31675066, 17853894

The protein

[SW|Domains]

[SW|Helicase ATP-binding domain] (aa 27-196) (according to UniProt)

[SW|Helicase C-terminal domain] (aa 216-367) (according to UniProt)

HRDC domain (aa 513-591) (according to UniProt)

The protein

[SW|Localization]

associated with the [SW|replisome] [pubmed|17853894]